Blog

The trait of medium-sized leaves in iris is determined by the genetic condition PP’. Plants with large leaves are PP, while plants with small leaves are P’P’. A cross is made between two plants each with medium-sized leaves. They produce 80 seedlings. How would you describe the genotype of the plants with medium-sized leaves?

The second tRNA to attach to the mRNA will be carrying the amino acid:

Regulating gene expression allows a cell to:

A chart that displays chromosomes arranged by size and structure.

A manifesting heterozygote…

Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?

Missing genetic material is usually less harmful than extra genetic material.

What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’

Points in the cell cycle where progress stops until a go-ahead signal is received.

After correctly transcribing the DNA sequence above, another BIOL 190 student then translated the resulting mRNA and gave the following answer: methionine, tyrosine, arginine, asparagine, alanine, proline, threonine, isoleucine, leucine, tryptophan, glutamine, glutamate Is this correct?