Why do the DNA fingerprints of non-related individuals differ?
Category: Uncategorized
Why is it important that the PCR enzyme be heat-stable?
Why is it important that the PCR enzyme be heat-stable?
Ligase forms [a] bonds between 5’ phosphate groups and 3’ -O…
Ligase forms [a] bonds between 5’ phosphate groups and 3’ -OH groups in DNA. Reverse transcriptase uses [c] as a template to form a complimentary [d] strand. RNA polymerase binds to the [b] (write coding or non-coding) DNA strand and forms a complimentary molecule of [e], through the process of trans[f]. The monomer units of proteins are [g]
Why do we need to stain DNA after gel electrophoresis?
Why do we need to stain DNA after gel electrophoresis?
After we transformed the bacterial cells, we plated them on…
After we transformed the bacterial cells, we plated them on both plain (no antibiotic) and antibiotic-containing agar plates. Why did we get only a few colonies of transformed cells on the antibiotic plate when the plain plate was covered in colonies?
PCR is a clever procedure. What type of enzyme is used to m…
PCR is a clever procedure. What type of enzyme is used to make this procedure workable? Why? Where is this enzyme from?
Transcribe the following DNA sequence: (in the first and thi…
Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end. Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’ Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon. This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation. Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]
In 1928 Fredrick Griffith experimented with two strains of S…
In 1928 Fredrick Griffith experimented with two strains of Streptococcus pneumoniae bacteria, smooth type (virulent) and rough type (non-virulent). If heat-killed S type was mixed with R type, the mixture was virulent. What was learned from this experiment?
Why are parasites so difficult to classify based on morpholo…
Why are parasites so difficult to classify based on morphology only?
All animals must get oxygen to tissues for cellular respirat…
All animals must get oxygen to tissues for cellular respiration. Which of the following is NOT involved in this critical function?