Mechanisms of DNA Damage and Repair-Professor Dave explains the chapterhttps://www.youtube.com/watch?v=sX6LncNjTFUA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Include in your answer:The start codon (AUG)Divide the sequence into codons (groups of three)Translate each codon with codon tableTranslate the mutant mRNA the same wayCompare the original and mutated proteins: lengths, differences, and premature stopExplain impact: Functional or non-functional proteinCodon Table: https://woodmontcollege.edu/moodle/pluginfile.php/289807/mod_resource/content/1/Codon_Table.pdf
Category: Uncategorized
What is the recommended delivery method for a public school…
What is the recommended delivery method for a public school project where budget and schedule are critical?
What is the recommended delivery method for a private luxury…
What is the recommended delivery method for a private luxury home that emphasizes customization, high-quality finishes, and innovative design?
The key feature that makes Construction Manager at Risk suit…
The key feature that makes Construction Manager at Risk suitable for public projects like schools is the provision of a [BLANK-1] early in the process, which provides budget certainty. Pick from these choices and fill in only the capitalized letter designation for the correct answer in the blank space: (A) Fixed fee only OR (B) Guaranteed Maximum Price (GMP) OR (C) Open competitive bid OR (D) Owner-managed schedule.
One potential con of Construction Manager at Risk for a publ…
One potential con of Construction Manager at Risk for a public school is the possibility of less competitive pricing if the CM is selected early without full bids.
Which of the following is listed as a pro of using Construct…
Which of the following is listed as a pro of using Construction Manager at Risk for a public school?
Two Bison is a good example of ___________.
Two Bison is a good example of ___________.
In comparing the Woman from Brassempouy to the Woman from Wi…
In comparing the Woman from Brassempouy to the Woman from Willendorf, the function of both is most probably ___________.
Megaliths arranged in circles are known as _______.
Megaliths arranged in circles are known as _______.
What are the following? Genetically modified foods, transi…
What are the following? Genetically modified foods, transitioning toward a plant-based diet that uses less resources, reducing food waste, population control, colonizing space