Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?
Blog
For a given gene, both strands of a DNA are used as a templa…
For a given gene, both strands of a DNA are used as a template simultaneously from one initiation point when which of the following molecules is synthesized?
A key modification in the 3 end of eukaryotic mRNA is the a…
A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?
In the diagram below, which letter indicates the 5’ end of t…
In the diagram below, which letter indicates the 5’ end of the leading strand?
Assume a DNA molecular, with the primary structure listed be…
Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell. In this double stranded DNA molecule, how many 3´ hydroxyls are present? 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC
What types of bonds are created between adjacent ribonucleot…
What types of bonds are created between adjacent ribonucleotides during the process of transcription?
Which of the following statements is TRUE of DNA polymerases…
Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?
Indicate which of the following statements is TRUE.
Indicate which of the following statements is TRUE.
A normal chromosome in a higher eukaryotic species would NOT…
A normal chromosome in a higher eukaryotic species would NOT be expected to contain:
Hershey and Chase conducted experiments using radioactive is…
Hershey and Chase conducted experiments using radioactive isotopes to label DNA and protein in separate bacteriophage cultures and track if each molecule was transferred into infected cells with the genetic material of the phage. Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA? What isoptope was used to label the DNA?