Blog

Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?

Indicate which of the following statements is TRUE.

A normal chromosome in a higher eukaryotic species would NOT be expected to contain:

Hershey and Chase conducted experiments using radioactive isotopes to label DNA and protein in separate bacteriophage cultures and track if each molecule was transferred into infected cells with the genetic material of the phage.  Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA? What isoptope was used to label the DNA?

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, there are 11 Ts, 12 Cs, 12 Gs, and 11 As.  How many purines are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

The Holliday model describes which of the following processes?

A molecule that consists of a nitrogenous base bonded to the 1′-carbon of a ribose or deoxyribose is a(n):

You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugation results, what type of replication would you propose for these new bacteria?  

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. You decide to attempt a transformation: seeing if you can convert the yellow form into the purple form. You combine two of the samples from the list below, and live purple form is observed, indicating transformation had occurred.  Which two samples did you combine (choose 2 from list below)?

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. You wish to discover which of those three molecules could be the genetic material. You heat-kill some of the purple life form and subject three different homogenized samples of the heat killed cells to different enzymes: DNase, RNase, or protease. Which sample will NOT transform yellow into purple if this is a cellular life form with the same genetic material as every other known cellular life forms?