Use the dsDNA sequence below to answer the following questio…

Use the dsDNA sequence below to answer the following questions.             AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA             TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT (10a) During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5’ and 3’ ends of each strand. (2)