Use the dsDNA sequence below to answer the following questions. AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT (10a) During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5’ and 3’ ends of each strand. (2)
Blog
A tRNA moves through the binding sites of the ribosome in wh…
A tRNA moves through the binding sites of the ribosome in what order? (3)
Match the term on the left with the correct definition on th…
Match the term on the left with the correct definition on the right. (1 each)
A client has a diagnosis of GERD and is receiving omeprazole…
A client has a diagnosis of GERD and is receiving omeprazole daily at bedtime and the nurse is reinforcing teaching on medication side effects. Which statement is most appropriate for the nurse to include in the teaching?
A nurse is preparing to administer dextrose 5% in water IV t…
A nurse is preparing to administer dextrose 5% in water IV to infuse at 100 mL/60 min. The drop factor on the manual IV tubing is 60 gtt/mL. The nurse should set the IV flow rate to deliver how many gtt/min?
A nurse is caring for a client who is taking cimetidine. Whi…
A nurse is caring for a client who is taking cimetidine. Which of the following client statements indicates to the nurse that the cimetidine treatment has been effective? (Select all that apply.)
Describe the process by which a prokaryotic cell makes a cop…
Describe the process by which a prokaryotic cell makes a copy of its chromosome. (10)
The Central Dogma of Molecular Biology is used to describe t…
The Central Dogma of Molecular Biology is used to describe the flow of genetic information within a cell. Draw a flow chart of the central dogma and identify the processes involved in each step. (3)
Bonus: What kind of biological molecule makes up the genome…
Bonus: What kind of biological molecule makes up the genome of the coronavirus that causes covid-19? (5)
(5b) Describe the mutation that resulted in the difference b…
(5b) Describe the mutation that resulted in the difference between the protein variants? Be as specific as possible. (2) Variant 1: Met Val Pro Gln Ala Trp Tyr Glu Variant 2: Met Val Pro Gln Ala Gly Tyr Glu