Cognitive behavioral theories in the treatment of eating disorders focus on all of the following EXCEPT: __________________________________.
Blog
Case Study 3 – Provide the correct numeric code, diagnosis,…
Case Study 3 – Provide the correct numeric code, diagnosis, and any specifiers Yvonne Perez was a 23-year-old woman who presented for an outpatient psychiatric evaluation 3 weeks after giving birth to her second child. She was referred by her breastfeeding nurse, who was concerned about the patient’s depressed mood, flat affect, and fatigue. * Ms. Perez said she had been worried and unenthusiastic since finding out she was pregnant. She and her husband planned to wait a few years before having another child, and her husband made it clear that he would have preferred that she terminate the pregnancy, an option she would not consider because of her religion. He had also been upset that she was “too tired” to do paid work outside of the home during her pregnancy. She became increasingly dysphoric, hopeless, and overwhelmed after the delivery. Breastfeeding was not going well, and she began to believe her baby was “rejecting me” by refusing her breast, spitting up her milk, and crying. Her baby became very colicky, so she felt forced to hold him most of the day. She wondered whether she deserved this difficulty because she had not wanted the pregnancy. * Her husband was gone much of the time for work, and she found it very difficult to take care of the new baby and her lively and demanding 16-month-old daughter. Over the past several weeks she slept little, felt constantly tired, cried often, and worried about how she was going to get through the day. Her mother-in-law had just arrived to help her care for the children, and she thought Ms. Perez just had the typical postpartum blues that result from “hormones being out of whack.” * Ms. Perez was an English-speaking Hispanic woman who had worked in a coffee shop until midway through her first pregnancy, almost 2 years earlier. She was raised in a supportive home by her parents and has a large extended family. She moved to a different region of the country when her husband was transferred for work, and she had no relatives nearby. Although no one in her family had seen a psychiatrist, several family members appeared to have been depressed. She had no prior psychiatric history or treatment. She denied illicit drug or alcohol use. She had smoked for several years but stopped when she was pregnant with her first child. Ms. Perez had a history of asthma. Aside from a multivitamin with iron, she took no medications. * On mental status examination, Ms. Perez was a casually dressed, cooperative young woman. She made some eye contact, but her eyes tended to drop to the floor when she spoke. Her speech was fluent but slow, with increased latency when answering questions. The tone of her speech was flat. She endorsed low mood, and her affect was constricted. She denied thoughts of suicide and homicide. She also denied any hallucinations and delusions, although she had considered whether the current situation was punishment for not wanting the child. She was fully oriented and could register three objects but only recalled one after 5 minutes. Her intelligence was average. Her insight and judgment were fair to good. * In the first blank, enter the correct numeric code for the disorder. In the second blank, enter the correct disorder name. In the third blank, enter all appropriate specifiers. [dsmcode] [dsmdiagnosis] [allappropriatespecifiers]
For early-stage lung cancer, post-surgical RT is recommended…
For early-stage lung cancer, post-surgical RT is recommended for all patients regardless of lymph node status.
Indicate ALL of the following cognitive-behavioral factors l…
Indicate ALL of the following cognitive-behavioral factors linked to behaviors to achieve or maintain thinness found in the Kring & Johnson text and slides. These behaviors are:
How many amino acids are encoded by the following mRNA? 5’G…
How many amino acids are encoded by the following mRNA? 5’GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′
All of the following are advantages for using standardized r…
All of the following are advantages for using standardized rating scales to measure client change except:
_______ is/are the primary skill(s) needed to engage clients…
_______ is/are the primary skill(s) needed to engage clients successfully at the beginning of the therapeutic relationship.
3000 cGy in 10 fractions using a 6 MV non-isocentric PA beam…
3000 cGy in 10 fractions using a 6 MV non-isocentric PA beam to a depth of 3 is to be delivered with a 15 x 15 FS and no blocking. The TAR is .952, the RDR is 0.993 cGy/MU, the PDD is .952, the FSF is 1.035 and the IFD is 20 cm. Calculate the MUs.
Your Kring & Johnson book and slides identify two therapies…
Your Kring & Johnson book and slides identify two therapies that are effective for treatment of Binge Eating Disorder. They are (indicate two of the below):
Part 2 – ProblemsOn the next 9 problems, SHOW ALL WORK. Aft…
Part 2 – ProblemsOn the next 9 problems, SHOW ALL WORK. After you submit your test, take pictures of your work for the 9 problems below and upload them to Canvas using the link “TEST 4 Work” that is underneath the link for this test in Canvas. Make sure that you show all work and write neatly and darkly enough for me to read it. If I can’t see or read your work, I cannot give you any credit.