Skip to content

Quiz Lookup

  • Home
  • Blog

Blog

Which of the following is an example of positive selection?

Which of the following is an example of positive selection?

Published June 16, 2021
Categorized as Uncategorized

True or False. The genetic code is degenerate, meaning each…

True or False. The genetic code is degenerate, meaning each amino acid can only be coded for by one codon.

Published June 16, 2021
Categorized as Uncategorized

What process occurred to the set of 2 double stranded DNA on…

What process occurred to the set of 2 double stranded DNA on the left to result in the 2 double stranded DNA on the right?

Published June 16, 2021
Categorized as Uncategorized

Below are the locations of genes on a chromosome.  Between w…

Below are the locations of genes on a chromosome.  Between which of the following genes would you observe the highest recombination frequency? A————– B—-C A————– B—-C

Published June 16, 2021
Categorized as Uncategorized

What type of CSSR genetic rearrangement occurs between two r…

What type of CSSR genetic rearrangement occurs between two recombination sites facing in the opposite direction (toward each other) on the same DNA molecule?

Published June 16, 2021
Categorized as Uncategorized

What binds to the stop codon?

What binds to the stop codon?

Published June 16, 2021
Categorized as Uncategorized

Bacterial repressors often work by

Bacterial repressors often work by

Published June 16, 2021
Categorized as Uncategorized

Using the two template DNA sequences below, determine what t…

Using the two template DNA sequences below, determine what type of mutation occurred. Normal DNA coding strand: 5’‐ATGTCACTTTGGTAGCAGGAT‐3’ Mutant DNA coding strand: 5’‐ATGTCACTTTGATAGCAGGAT‐3’

Published June 16, 2021
Categorized as Uncategorized

In eukaryotic translation initiation, the mRNA binds the sma…

In eukaryotic translation initiation, the mRNA binds the small subunit before the tRNA does.

Published June 16, 2021
Categorized as Uncategorized

Our immune system rearranges DNA to create new antibodies th…

Our immune system rearranges DNA to create new antibodies through

Published June 16, 2021
Categorized as Uncategorized

Posts pagination

Newer posts Page 1 … Page 43,688 … Page 56,629 Older posts
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Quiz Lookup
Proudly powered by WordPress.