Meier-Gorlin syndrome results from flaws in the licensing of origins in replication. Which is the most likely effect on DNA replication in effected individuals?
Blog
Prokaryotic promoters contain the sequence TATAAT at a posit…
Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.
Which of the following molecules is synthesized using nucleo…
Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?
For a given gene, both strands of a DNA are used as a templa…
For a given gene, both strands of a DNA are used as a template simultaneously from one initiation point when which of the following molecules is synthesized?
A key modification in the 3 end of eukaryotic mRNA is the a…
A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?
In the diagram below, which letter indicates the 5’ end of t…
In the diagram below, which letter indicates the 5’ end of the leading strand?
Assume a DNA molecular, with the primary structure listed be…
Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell. In this double stranded DNA molecule, how many 3´ hydroxyls are present? 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC
What types of bonds are created between adjacent ribonucleot…
What types of bonds are created between adjacent ribonucleotides during the process of transcription?
Which of the following statements is TRUE of DNA polymerases…
Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?
Indicate which of the following statements is TRUE.
Indicate which of the following statements is TRUE.