Blog

A milky cyst caused by an obstruction of the lactiferous duct in a lactating or pregnant patient is called:

Which imaging guided procedure is done immediately before surgery to help the surgeon find a lesion?

42.  Use the sequence below to answer the following questions.  5′ AUGUGGACAGAUAGCUGGGGCAAAAAAUGAAAAAAAAAA 3′  If the second codon above, UGG, was changed to UGA, what type of mutation would this be? 

A 22 y/o F presents to the ultrasound department with a palpable breast mass.   You perform a breast sonogram , you find this mass at RT 2:00 3CM FN.  The patient requests a biopsy due to a strong family history of breast CA.  The mass is biopsied and the tissue comes back as the most common solid benign breast mass. A) What was the mass? (1 point) B) List three (3) sonographic characteristics that are more commonly benign sonographic findings in the above breast mass: (3 points)

A majority of breast cancers arise from what structure?

43. FREE POINT! =)  Select the FREE POINT below! 

Which of the following is not a characteristic of a simple cyst?

A hamartoma is also called:

32. You discover a new bacterial protein that contains 200 amino acids.  You are attempting to locate the gene that encodes for this protein.  The gene you are looking for could contain how many nucleotides? (Hint- remember how many nucleotides code for each amino acid in the genetic code) 

6. While studying water samples from Jupiter’s moon Europa for NASA you discover a new prokaryotic species! How cool!  Following the DNA base-pairing rules of Earth organisms, if you find the organism to have a 30% Adenine base content in its DNA what % of Guanine base would you expect to find?