The ability to react more strongly to a subsequent infection is a feature of which of the following?
Blog
What is a MOTO-CAR?
What is a MOTO-CAR?
Which one of the following statements about restriction frag…
Which one of the following statements about restriction fragment length polymorphisms (RFLPs) is correct?
You are a doctor examining a patient’s blood test reports. Y…
You are a doctor examining a patient’s blood test reports. You are looking at the ratio of helper T cells and cytotoxic T cells. Helper T cells ________; cytotoxic T cells ________. You can tell them apart by the type of protein they ________.
Which of the following describes adaptive immunity?
Which of the following describes adaptive immunity?
The job of a natural killer cell is to ________.
The job of a natural killer cell is to ________.
Here is a guide to what the following diagram means: K and…
Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing). An alien ship crash lands in Payson, UT. As part of a secret government team, you go to investigate, where you find an alien life form with an RNA polymerase that, strangely, transcribes DNA from the 3′ to 5′ direction (a feature never seen on Earth). Imagine that the alien polymerase were to transcribe strand K. What would be the outcome? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC
In New Mexico, large expanses of black lava create patches o…
In New Mexico, large expanses of black lava create patches of unique habitat. If, in every generation, selection favors the darkest-colored pocket mice in those habitats because they are best hidden from predators, this would be an example of ________.
Some forms of diabetes and arthritis are examples of _______…
Some forms of diabetes and arthritis are examples of ________.
You are looking at a muscle cell and analyzing the events th…
You are looking at a muscle cell and analyzing the events that lead to muscle contraction. You find that there is a pump called the sodium potassium ATPase that will pump potassium into cells while also pumping sodium out of cells both against their concentration gradients. You think for a second and realize that this process is very similar to one of the processes you have studied. Which of the following is most similar to this process?