Blog

The mean free path of an oxygen molecule is 2.0 × 10-5 m, when the gas is at a pressure of 120 Pa and a temperature of 350 K. The molecular mass of oxygen is 32.0 g/mol and the Boltzmann constant is 1.38 × 10-23 J/K, Avogadro’s number is 6.02 × 1023 molecules/mole, and the ideal gas constant is R = 8.314 J/mol · K = 0.0821 L · atm/mol · K. Assuming that the molecules are moving at their root-mean-square speeds, the average time interval between collisions of an oxygen molecule is closest to

Let u=3-2-4,v=-617,w=0-12 \mathbf u = \begin{bmatrix} 3 \\ -2 \\ -4 \end{bmatrix}, \mathbf v = \begin{bmatrix} -6 \\ 1 \\ 7 \end{bmatrix}, \mathbf w = \begin{bmatrix}0 \\ -1 \\ 2 \end{bmatrix} , and z=-9612 \mathbf z = \begin{bmatrix} -9 \\ 6 \\12 \end{bmatrix}Which set is linearly dependent?

pick A

Which one of the following types of post-transcriptional modification is common in prokaryotes?

Transformation in bacteria is a very useful method used by scientists to insert a plasmid into bacteria so that bacteria will produce a wanted product. A great example of this is insulin production. What is an easy test that scientists commonly use that indicates that transformation was successful?

In the reactions of glycolysis, acetyl-CoA formation and the citric acid cycle, chemical energy is transferred to the bonds in ________.

Consider the structure and function of DNA. Which of the following statements is true?

Which of the following nucleotides most commonly pairs with guanine?

Hershey and Chase performed an experiment with viruses and radioactive dye. What main conclusion did they come to?

DNA Sequence Chart For questions 62–65, use the following DNA sequence and diagram.5’ TAGAATGCGCCTACGTCGATAA 3’3’ ATCTTACGCGGATGCAGCTATT 5’ Image Description A detailed genetic code table, which is a critical reference in molecular biology for understanding how genetic information in DNA and mRNA sequences is translated into proteins. The table is organized into four columns and four rows, with each cell containing a three-letter codon corresponding to either an amino acid or a stop signal. The first column and row are labeled with the nucleotides U (uracil), C (cytosine), A (adenine), and G (guanine). Each codon is listed with its designated amino acid, for example, “UUU (phenylalanine)” or a stop signal as in “UAA (stop).” The colors—purple, green, yellow, and blue—differentiate between the four starting nucleotides of the codons. A key amino acid, “AUG (methionine or start),” is highlighted as the common starting point for protein synthesis. This table is a standard tool for geneticists, providing the essential code for translating nucleotide sequences into the amino acid sequences of proteins. Codons and the corresponding amino acids: U UU UUU (phenylalanine) UUC (phenylalanine) UUA (leucine) UUG (leucine) UC UCU (serine) UCC (serine) UCA (serine) UCG (serine) UA UAU (tyrosine) UAC (tyrosine) UAA (stop) UAG (stop) UG UGU (cysteine) UGC (cysteine) UGA (stop) UGG (tryptophan) C CU CUU (leucine) CUC (leucine) CUA (leucine) CUG (leucine) CC CCU (proline) CCC (proline) CCA (proline) CCG (proline) CA CAU (histidine) CAC (histidine) CAA (glutamine) CAG (glutamine) CG CGU (arginine) CGC (arginine) CGA (arginine) CGG (arginine) A AU AUU (isoleucine) AUC (isoleucine) AUA (isoleucine) AUG (methionine or start) AC ACU (threonine) ACC (threonine) ACA (threonine) ACG (threonine) AA AAU (asparagine) AAC (asparagine) AAA (lysine) AAG (lysine) AG AGU (serine) AGC (serine) AGA (arginine) AGG (arginine) G GU GUU (valine) GUC (valine) GUA (valine) GUG (valine) GC GCU (alanine) GCC (alanine) GCA (alanine) GCG (alanine) GA GAU (aspartic acid) GAC (aspartic acid) GAA (glutamic acid) GAG (glutamic acid) GG GGU (glycine) GGC (glycine) GGA (glycine) GGG (glycine)