Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?
Blog
Missing genetic material is usually less harmful than extra…
Missing genetic material is usually less harmful than extra genetic material.
What would happen, if anything, to the amino acid sequence i…
What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’
Points in the cell cycle where progress stops until a go-ahe…
Points in the cell cycle where progress stops until a go-ahead signal is received.
After correctly transcribing the DNA sequence above, another…
After correctly transcribing the DNA sequence above, another BIOL 190 student then translated the resulting mRNA and gave the following answer: methionine, tyrosine, arginine, asparagine, alanine, proline, threonine, isoleucine, leucine, tryptophan, glutamine, glutamate Is this correct?
In which cell type would a cell plate form after telophase i…
In which cell type would a cell plate form after telophase is complete?
The leading strand is built __________ the replication fork…
The leading strand is built __________ the replication fork and the lagging strand is built __________ the replication fork.
All of the following are correct about mutations except:
All of the following are correct about mutations except:
Regulating the production of enzymes is achieved through:
Regulating the production of enzymes is achieved through:
The first tRNA to attach to the mRNA will be carrying the am…
The first tRNA to attach to the mRNA will be carrying the amino acid: