DNA Sequence Chart For questions 62–65, use the following DN…

DNA Sequence Chart For questions 62–65, use the following DNA sequence and diagram.5’ TAGAATGCGCCTACGTCGATAA 3’3’ ATCTTACGCGGATGCAGCTATT 5’ Image Description A detailed genetic code table, which is a critical reference in molecular biology for understanding how genetic information in DNA and mRNA sequences is translated into proteins. The table is organized into four columns and four rows, with each cell containing a three-letter codon corresponding to either an amino acid or a stop signal. The first column and row are labeled with the nucleotides U (uracil), C (cytosine), A (adenine), and G (guanine). Each codon is listed with its designated amino acid, for example, “UUU (phenylalanine)” or a stop signal as in “UAA (stop).” The colors—purple, green, yellow, and blue—differentiate between the four starting nucleotides of the codons. A key amino acid, “AUG (methionine or start),” is highlighted as the common starting point for protein synthesis. This table is a standard tool for geneticists, providing the essential code for translating nucleotide sequences into the amino acid sequences of proteins. Codons and the corresponding amino acids: U UU UUU (phenylalanine) UUC (phenylalanine) UUA (leucine) UUG (leucine) UC UCU (serine) UCC (serine) UCA (serine) UCG (serine) UA UAU (tyrosine) UAC (tyrosine) UAA (stop) UAG (stop) UG UGU (cysteine) UGC (cysteine) UGA (stop) UGG (tryptophan) C CU CUU (leucine) CUC (leucine) CUA (leucine) CUG (leucine) CC CCU (proline) CCC (proline) CCA (proline) CCG (proline) CA CAU (histidine) CAC (histidine) CAA (glutamine) CAG (glutamine) CG CGU (arginine) CGC (arginine) CGA (arginine) CGG (arginine) A AU AUU (isoleucine) AUC (isoleucine) AUA (isoleucine) AUG (methionine or start) AC ACU (threonine) ACC (threonine) ACA (threonine) ACG (threonine) AA AAU (asparagine) AAC (asparagine) AAA (lysine) AAG (lysine) AG AGU (serine) AGC (serine) AGA (arginine) AGG (arginine) G GU GUU (valine) GUC (valine) GUA (valine) GUG (valine) GC GCU (alanine) GCC (alanine) GCA (alanine) GCG (alanine) GA GAU (aspartic acid) GAC (aspartic acid) GAA (glutamic acid) GAG (glutamic acid) GG GGU (glycine) GGC (glycine) GGA (glycine) GGG (glycine)

Often, scientists will work with mice that are missing a gen…

Often, scientists will work with mice that are missing a gene. This is done to determine downstream effects and viability. If a mouse were missing only one gene but lacked the protein production for three different proteins, what would best explain why this happened?