Transcribe the following DNA sequence: (in the first and thi…

Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end.  Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’   Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon.   This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation.  Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]

In 1928 Fredrick Griffith experimented with two strains of S…

In 1928 Fredrick Griffith experimented with two strains of Streptococcus pneumoniae bacteria, smooth type (virulent) and rough type (non-virulent).  If heat-killed S type was mixed with R type, the mixture was virulent.  What was learned from this experiment?

A geneticist is studying sexual reproduction of a species of…

A geneticist is studying sexual reproduction of a species of butterfly that lives in a very cold climate.  He hypothesizes that there should be low genetic diversity because it is well adapted to the cold climate but does not seem to be able to colonize surrounding areas with warmer climates.  What important principle is he using to formulate his hypothesis?