Blog

Objectives, surveys, and 360-degree evaluations are methods to assess the performance of:  

Why do the DNA fingerprints of non-related individuals differ? 

Why is it important that the PCR enzyme be heat-stable? 

Ligase forms [a] bonds between 5’ phosphate groups and 3’ -OH groups in DNA.   Reverse transcriptase uses [c] as a template to form a complimentary [d] strand.   RNA polymerase binds to the [b] (write coding or non-coding) DNA strand and forms a complimentary molecule of [e], through the process of trans[f]. The monomer units of proteins are [g]

Why do we need to stain DNA after gel electrophoresis? 

After we transformed the bacterial cells, we plated them on both plain (no antibiotic) and antibiotic-containing agar plates.  Why did we get only a few colonies of transformed cells on the antibiotic plate when the plain plate was covered in colonies?

PCR is a clever procedure.  What type of enzyme is used to make this procedure workable?  Why?  Where is this enzyme from?

Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end.  Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’   Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon.   This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation.  Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]

In 1928 Fredrick Griffith experimented with two strains of Streptococcus pneumoniae bacteria, smooth type (virulent) and rough type (non-virulent).  If heat-killed S type was mixed with R type, the mixture was virulent.  What was learned from this experiment?

Why are parasites so difficult to classify based on morphology only?