Blog

Why are procedures more effective than rules for daily classroom functioning?

Which of the following is/are feature(s) that distinguish cancer cells from normal cells?

If you were to look at a slide of cells from an area of the body where cells are constantly being replaced (such as the skin), what stage of the cell cycle would most of the cells be in?

During one of the phases of mitosis, the chromosomes are lined up in the middle of the dividing cell. Which of the following events would occur at some point after this phase (rather than before)?

SHORT ANSWER (10 pts) Carla works for a non-profit organization that is trying to motivate people to call their congressperson and voice their concern about pollution from fossil fuels. She is designing billboard ads that will hopefully motivate people to do this! Using your understanding of the action tendencies of different emotions, explain why it could be that sparking some specific emotion could be counter-productive in this situation. That is, your task is to explain one emotion that would NOT be helpful to produce in this situation, AND why would it be not helpful (due to its action tendencies). In your answer, make sure to (1) first, explain the action tendencies of the emotion you choose, and (2) second, why those actions would NOT be helpful in this situation.  Note: you cannot use Fear or Hope for your answer to this question.

Here are a D N A sequence and the cut patterns of two different restriction enzymes. Which of the following is false based on the sequence and restriction enzymes? 5′ TAATCGAATTGGCCGCTGCAGAATGGCCCTGACCTTCA 3′ 3′ ATTAGCTTAACCGGCGACGTCTTACCGGGACTGGAAGT 5′  

In the product label below, which of the motivations of green consumer psychology is the phrase “PREMIUM COFFEE EXPERIENCE… TASTE THE COFFEE NOT THE PLASTIC!” is trying to resonate with?

SHORT ANSWER (10 pts) When discussing the role of the news media in environmental communication, we talked about how one of the realities of the current news media industry is that most news sources and media companies are “optimizing for views.”   What effect might this have on the way that environmental issues are covered in the news?  Answer with a brief paragraph. note: There are multiple possible correct answers to this question. A few of them were discussed during lecture.

SHORT ANSWER (10 pts) Organizations and industries that are opposed to environmental regulations and pro-environmental action tend to use a few different communication strategies. One of them that we discussed in class is “politicization of the issue.” Why would politicization of environmental issues be a strategy of opposition? Explain why using a political issue frame might slow or hinder action by those who want to take action with solutions.

Why does cooperative learning require strong procedures?