Which phylogeny is best supported by the DNA sequence similarity data in the table below? birds crocodilians lepidosaurs (lizards) turtles mammals birds 100% crocodilians 85% 100% lepidosaurs (lizards) 73% 72% 100% turtles 71% 73% 92% 100% mammals 59% 57% 60% 59% 100% Hint: Compare all of the DNA similarities.
Blog
Red-green color blindness in humans is inherited as a recess…
Red-green color blindness in humans is inherited as a recessive X-linked trait. The allele for normal vision is B, and the allele for colorblindness is b. A husband and wife have 4 sons and 2 daughters. All 4 sons are color-blind, but none of the daughters are color-blind. What are the most likely genotypes of the parents?
Researchers hypothesize that a new drug, Galliprant, reduces…
Researchers hypothesize that a new drug, Galliprant, reduces joint pain and increases agility in senior dogs. They design an experiment to test their hypothesis where they give 200 senior dogs a 25 mg Galliprant pill a day and another group of 200 senior dogs a placebo without Galliprant. Every day for a month, all dogs will be observed to see how long they remain standing and active at a dog park, versus laying down to rest. Results will then be compared between groups to determine how effective the treatment was. In this experiment: what was the dependent variable? [dependent1] what was the independent variable? [independent1]
Duchenne muscular dystrophy (DMD) is an especially severe ge…
Duchenne muscular dystrophy (DMD) is an especially severe genetic disorder caused by mutations in the gene encoding dystrophin. Beginning in 2018, several pilot studies were initiated to see if genetic engineers could correct mutations in the dystrophin gene using the CRISPR-Cas9 system. In these trial experiments, a modified adenovirus was used to deliver the CRISPR-Cas9 system into a muscle cell, which would then modify the dystrophin gene. While successful, more work remains to be done to ensure that such treatments can be used to safely in actual patients. Genetic technology used to treat a disease in an individual is known as ________.
Use the table below to transcribe and translate the followin…
Use the table below to transcribe and translate the following DNA sequence and identify the final polypeptide strand. DNA: 3′ – TACAGAGGTCCCTTGGTA – 5′
In 2000, the artist Eduardo Kac unveiled his bio-engineered…
In 2000, the artist Eduardo Kac unveiled his bio-engineered art piece named “Alba,” a transgenic rabbit created using transformation. Alba’s cells carried a gene derived from jellyfish that produces GFP, a green fluorescent protein. When Alba was illuminated with UV light, she fluoresced a bright lime green color. To create Alba, genetic engineers had to first create a/an recombinant DNA vector that consisted of a rabbit [regulatory] gene and the jellyfish [coding] gene that produced GFP. This vector was then inserted into the genome of the embryo that ultimately developed into Alba.
In a population of cows, a single gene controls hair type. T…
In a population of cows, a single gene controls hair type. The curly hair allele (H) shows incomplete dominance with the straight hair allele (h). The hair of heterozygous individuals (Hh) is wavy. Another gene controls coat color. The red (R) and white (r) alleles are co-dominant. The coloring of heterozygous individuals (Rr) is called roan [pictured below]. After breeding a wavy, roan bull with several wavy, roan females, you observed the following phenotypic ratio in the offspring: 9 curly, white : 18 wavy, roan : 8 straight, red Part 1: Based on this observed ratio, are the two genes linked? [true_false] Part 2: If they are linked, what way are the alleles of the two genes linked? [answer2]
You are studying three newly discovered frog species found i…
You are studying three newly discovered frog species found in a remote, isolated part of the Amazon. To determine how they are related to the more common frog species found throughout the Amazon, you collect and sequence a DNA sample from each species. Below are the results, shown as a single strand of DNA for each species. New species A: GGATCGAGATCTGTCGAACTNew species B: GGACGCAGATCATTAGGACTNew species C: GGACCCAGATCAGTAGGACTCommon frog: GGATCCAGATCTGTCGGAGT Based on these data, what species is most closely related to the common frog species?
A 70-year female patient has the BRCA2 mutation. Based on th…
A 70-year female patient has the BRCA2 mutation. Based on the data below, her increased risk of developing breast cancer is nearly [answer1] times that of the general population.
Researchers hypothesize that glucosamine reduces joint pain…
Researchers hypothesize that glucosamine reduces joint pain and increases agility in senior dogs. They design an experiment to test their hypothesis where they give 50 senior dogs a 1000 mg glucosamine supplement a day and another group of 50 senior dogs a placebo without glucosamine. Every day for a month, all dogs will be measured and timed on a simple agility run. Results will then be compared between groups to determine how effective the treatment was. In this experiment: what was the dependent variable? [dependent1] what was the independent variable? [independent1]