Use the table below to transcribe and translate the following DNA sequence and identify the final polypeptide strand. DNA: 3′ – TACAGAGGTCCCTTGGTA – 5′
Blog
In 2000, the artist Eduardo Kac unveiled his bio-engineered…
In 2000, the artist Eduardo Kac unveiled his bio-engineered art piece named “Alba,” a transgenic rabbit created using transformation. Alba’s cells carried a gene derived from jellyfish that produces GFP, a green fluorescent protein. When Alba was illuminated with UV light, she fluoresced a bright lime green color. To create Alba, genetic engineers had to first create a/an recombinant DNA vector that consisted of a rabbit [regulatory] gene and the jellyfish [coding] gene that produced GFP. This vector was then inserted into the genome of the embryo that ultimately developed into Alba.
In a population of cows, a single gene controls hair type. T…
In a population of cows, a single gene controls hair type. The curly hair allele (H) shows incomplete dominance with the straight hair allele (h). The hair of heterozygous individuals (Hh) is wavy. Another gene controls coat color. The red (R) and white (r) alleles are co-dominant. The coloring of heterozygous individuals (Rr) is called roan [pictured below]. After breeding a wavy, roan bull with several wavy, roan females, you observed the following phenotypic ratio in the offspring: 9 curly, white : 18 wavy, roan : 8 straight, red Part 1: Based on this observed ratio, are the two genes linked? [true_false] Part 2: If they are linked, what way are the alleles of the two genes linked? [answer2]
You are studying three newly discovered frog species found i…
You are studying three newly discovered frog species found in a remote, isolated part of the Amazon. To determine how they are related to the more common frog species found throughout the Amazon, you collect and sequence a DNA sample from each species. Below are the results, shown as a single strand of DNA for each species. New species A: GGATCGAGATCTGTCGAACTNew species B: GGACGCAGATCATTAGGACTNew species C: GGACCCAGATCAGTAGGACTCommon frog: GGATCCAGATCTGTCGGAGT Based on these data, what species is most closely related to the common frog species?
A 70-year female patient has the BRCA2 mutation. Based on th…
A 70-year female patient has the BRCA2 mutation. Based on the data below, her increased risk of developing breast cancer is nearly [answer1] times that of the general population.
Researchers hypothesize that glucosamine reduces joint pain…
Researchers hypothesize that glucosamine reduces joint pain and increases agility in senior dogs. They design an experiment to test their hypothesis where they give 50 senior dogs a 1000 mg glucosamine supplement a day and another group of 50 senior dogs a placebo without glucosamine. Every day for a month, all dogs will be measured and timed on a simple agility run. Results will then be compared between groups to determine how effective the treatment was. In this experiment: what was the dependent variable? [dependent1] what was the independent variable? [independent1]
In a controlled experiment, typically only one factor is int…
In a controlled experiment, typically only one factor is intentionally changed between the experimental treatment and the control treatment. What factor is changed?
Alleles are alternate versions of [same] gene(s) that can re…
Alleles are alternate versions of [same] gene(s) that can result in [phenotypes].
In 2000, the artist Eduardo Kac unveiled his bio-engineered…
In 2000, the artist Eduardo Kac unveiled his bio-engineered art piece named “Alba,” a transgenic rabbit created using transformation. Alba’s cells carried a gene derived from jellyfish that produces GFP, a green fluorescent protein. When Alba was illuminated with UV light, she fluoresced a bright lime green color. To create Alba, genetic engineers had to first create a/an recombinant DNA vector that consisted of a jellyfish [coding] gene that produced GFP and a rabbit [regulatory] gene. This vector was then inserted into the genome of the embryo that ultimately developed into Alba.
The “ABO” blood group in humans is characterized by a single…
The “ABO” blood group in humans is characterized by a single gene with three alleles: A, B, and O. A and B are co-dominant with each other, while O is recessive to both A and B. These allelic interactions give rise to four possible phenotypes: type A, B, O, or AB blood. Given the allelic interactions described above, some phenotypes can result from more than one genotype (e.g., the genotypes AO and AA both result in type A blood). Suppose a woman with type O blood gives birth. After taking her child home from the hospital, she discovers the child has the following phenotype: type AB blood. Given both the mother and child’s phenotypes, which of the following conclusions is correct?