Blog

Here are a D N A sequence and the cut patterns of two different restriction enzymes. Which of the following is false based on the sequence and restriction enzymes? 5′ TAATCGAATTGGCCGCTGCAGAATGGCCCTGACCTTCA 3′ 3′ ATTAGCTTAACCGGCGACGTCTTACCGGGACTGGAAGT 5′  

A client with rheumatoid arthritis is receiving adalimumab sub-cutaneous injections. The nurse would educate the client to report which of the following symtpom(s) immediately to the provider? 

A client with rheumatoid arthritis is receiving adalimumab sub-cutaneous injections. The nurse would educate the client to report which of the following symtpom(s) immediately to the provider? 

A pediatric nurse works in a clinic and is preparing vaccines for a child. The child has cold symptoms and an ear infection. The mother is asking about delaying the vaccine administration. What is the best response by the nurse? 

A client with cancer is receiving chemotherapy. Today the white blood cell count is trending down. The provider orders a hematopoietic drug, Neupogen. What is a benefit to using hematopoietic drugs during chemotherapy? 

Firing an employee for her refusal to violate the law could raise a claim of wrongful discharge.

Which of the following people is an agent?

An ICU nurse is concerned that a client may be having an infusion reaction to Amphotericin B. What symptoms would be indicative of this adverse effect? 

Match the vaccine with the correct descriptive information.

A female client has been diagnosed with a vaginal yeast infection after receiving a course of antibiotics. What medication does the nurse anticipate will be ordered for the client?