Blog

Firing an employee for her refusal to violate the law could raise a claim of wrongful discharge.

A rule that is not intentionally discriminatory, but which may be discriminatory in practice because it excludes too many people in a protected group (or category) is considered:

Which of the following vaccines has a low risk of febrile seizures in children? 

You look through a microscope at a cell currently undergoing cell division and notice a cell plate beginning to develop in the middle of the cell. Based on this information, the cell is most likely:

One type of cancer therapy that we did not talk about in the cancer lecture is anti-angiogenic therapy, which is a therapy used to treat some types of cancer. We did, however, discuss angiogenesis. Based on what you know of angiogenesis, why might preventing angiogenesis be useful towards treating cancer?

Does the Family and Medical Leave Act apply to professionals like CPAs?

Many anti-cancer drugs affect cells undergoing mitosis. If an anti-cancer drug disrupts the formation of microtubules, which of the following will be most directly affected?

Here are a D N A sequence and the cut patterns of two different restriction enzymes. Which of the following is false based on the sequence and restriction enzymes? 5′ TAATCGAATTGGCCGCTGCAGAATGGCCCTGACCTTCA 3′ 3′ ATTAGCTTAACCGGCGACGTCTTACCGGGACTGGAAGT 5′  

What is the direction in which RNA polymerase synthesizes the RNA strand?

In cooperative learning, why must group roles be explicitly taught?