One type of cancer therapy that we did not talk about in the…

One type of cancer therapy that we did not talk about in the cancer lecture is anti-angiogenic therapy, which is a therapy used to treat some types of cancer. We did, however, discuss angiogenesis. Based on what you know of angiogenesis, why might preventing angiogenesis be useful towards treating cancer?

Here are a D N A sequence and the cut patterns of two differ…

Here are a D N A sequence and the cut patterns of two different restriction enzymes. Which of the following is false based on the sequence and restriction enzymes? 5′ TAATCGAATTGGCCGCTGCAGAATGGCCCTGACCTTCA 3′ 3′ ATTAGCTTAACCGGCGACGTCTTACCGGGACTGGAAGT 5′