Blog

Which patient should the nurse question an order received for acetaminophen?

The nurse is assessing a client who has decreased bowel sounds and abdominal distention. Which of the following laxatives would the nurse want to hold and call the provider before administering

Which of the following vaccines has a low risk of febrile seizures in children? 

Does the Family and Medical Leave Act apply to professionals like CPAs?

A home health nurse is caring for an elderly client. The client has been taking lansoprazole for several months to treat heartburn symptoms. What is a high concern to the nurse regarding the long term use of this medication? 

Many anti-cancer drugs affect cells undergoing mitosis. If an anti-cancer drug disrupts the formation of microtubules, which of the following will be most directly affected?

EXTRA CREDIT Match the correct opioid to the accurate descriptor

LAST QUESTION (free points) You probably studied hard on some concepts that did not end up making it into this exam. For this question, briefly explain any 1 concept from the class that was not the focus of any question so far on this exam. For your answer, first define that concept and then give a realistic example of that concept in the real world.

A client with cancer is receiving aldesleukin. The nurse is assessing for capillary leak syndrome. What would concern the nurse, if assessed, that the client is experiencing this adverse effect? 

Here are a D N A sequence and the cut patterns of two different restriction enzymes. Which of the following is false based on the sequence and restriction enzymes? 5′ TAATCGAATTGGCCGCTGCAGAATGGCCCTGACCTTCA 3′ 3′ ATTAGCTTAACCGGCGACGTCTTACCGGGACTGGAAGT 5′