Blog

Question 5 Spin and Angular Momentum Addition: 10 Points 5a) Identify all the operators from J2, L2, S2, Lz, Sz that commute with Jz. (We are using standard notation e.g. J = L + S.) [5 points] Hints: Use                1.) J2=Jx2+Jy2+Jz2  (and similarly for L2 and S2),                                   2.) [A2,B]= A[A,B]+[A,B]A                                   3.)    [Jx​,Jy​]=iℏJz​,     [Jy​,Jz​]=iℏJx​,    [Jz​,Jx​]=iℏJy​    (and similarly for L and S)   5b) Write |j = 5/2, mj= 3/2〉as a sum over |l = 2, ml〉|s = 1/2, ms〉states using Clebsch-Gordon coefficients. [5 points] Hints: ml can take values of -2,-1,0,1,2 and ms can take values of -1/2, +1/2, with the restriction that mj=3/2=ml+ms The only two combinations that satisfy mj=3/2=ml+ms are ml=2, ms=-1/2 and mj=1 and ms=+1/2. Use the j=5/2 and mj=3/2 vertical line in the CG table to get the appropriate CG coefficients.

A.   B.   C. Using the lecture and the textbook, match each statement to the correct image.

Mechanisms of DNA Damage and Repair-Professor Dave explains the chapterhttps://www.youtube.com/watch?v=sX6LncNjTFUA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Include in your answer:The start codon (AUG)Divide the sequence into codons (groups of three)Translate each codon with codon tableTranslate the mutant mRNA the same wayCompare the original and mutated proteins: lengths, differences, and premature stopExplain impact: Functional or non-functional proteinCodon Table: https://woodmontcollege.edu/moodle/pluginfile.php/289807/mod_resource/content/1/Codon_Table.pdf

What is the recommended delivery method for a public school project where budget and schedule are critical?

What is the recommended delivery method for a private luxury home that emphasizes customization, high-quality finishes, and innovative design?

One potential con of Construction Manager at Risk for a public school is the possibility of less competitive pricing if the CM is selected early without full bids.

The key feature that makes Construction Manager at Risk suitable for public projects like schools is the provision of a [BLANK-1] early in the process, which provides budget certainty. Pick from these choices and fill in only the capitalized letter designation for the correct answer in the blank space: (A) Fixed fee only OR (B) Guaranteed Maximum Price (GMP) OR (C) Open competitive bid OR (D) Owner-managed schedule.

Which of the following is listed as a pro of using Construction Manager at Risk for a public school?

Two Bison is a good example of ___________.

In comparing the Woman from Brassempouy to the Woman from Willendorf, the function of both is most probably ___________.