Question 5 Spin and Angular Momentum Addition: 10 Points 5a)…

Question 5 Spin and Angular Momentum Addition: 10 Points 5a) Identify all the operators from J2, L2, S2, Lz, Sz that commute with Jz. (We are using standard notation e.g. J = L + S.) [5 points] Hints: Use                1.) J2=Jx2+Jy2+Jz2  (and similarly for L2 and S2),                                   2.) [A2,B]= A[A,B]+[A,B]A                                   3.)    [Jx​,Jy​]=iℏJz​,     [Jy​,Jz​]=iℏJx​,    [Jz​,Jx​]=iℏJy​    (and similarly for L and S)   5b) Write |j = 5/2, mj= 3/2〉as a sum over |l = 2, ml〉|s = 1/2, ms〉states using Clebsch-Gordon coefficients. [5 points] Hints: ml can take values of -2,-1,0,1,2 and ms can take values of -1/2, +1/2, with the restriction that mj=3/2=ml+ms The only two combinations that satisfy mj=3/2=ml+ms are ml=2, ms=-1/2 and mj=1 and ms=+1/2. Use the j=5/2 and mj=3/2 vertical line in the CG table to get the appropriate CG coefficients.

Mechanisms of DNA Damage and Repair-Professor Dave explains…

Mechanisms of DNA Damage and Repair-Professor Dave explains the chapterhttps://www.youtube.com/watch?v=sX6LncNjTFUA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Include in your answer:The start codon (AUG)Divide the sequence into codons (groups of three)Translate each codon with codon tableTranslate the mutant mRNA the same wayCompare the original and mutated proteins: lengths, differences, and premature stopExplain impact: Functional or non-functional proteinCodon Table: https://woodmontcollege.edu/moodle/pluginfile.php/289807/mod_resource/content/1/Codon_Table.pdf

The key feature that makes Construction Manager at Risk suit…

The key feature that makes Construction Manager at Risk suitable for public projects like schools is the provision of a [BLANK-1] early in the process, which provides budget certainty. Pick from these choices and fill in only the capitalized letter designation for the correct answer in the blank space: (A) Fixed fee only OR (B) Guaranteed Maximum Price (GMP) OR (C) Open competitive bid OR (D) Owner-managed schedule.