Blog

What is the function of what is labeled “Ori” or “Origin” in a bacterial plasmid?

Genetic Technology (25 pts)

Forward primer 5’ AAGCTTATGGCCGGCCCCAGCCTCGC     (with added HindIII linker) Reverse primer 5’ GAATTCTCAGCGCTGGGAGAAGGTGG     (with added EcoRI linker) Figure.  The primers used in the polymerase chain reaction.  Target-matching section of the primer is underlined.  The added recognition sequence and and cut site for one of two restriction enzymes is shown in italics.   What is the purpose of the 12 italicized nucleotides (that aren’t complementary to the target DNA!) at the 5’ of each of the primers shown above?

The drawing below shows an E. coli DNA replication fork just left of where replication begins.  On the diagram the following conventions are used:   Grey, rounded rectangles label the ends of molecules (e.g. N, C, 5’, 3’) White rectangles label named nucleic acid molecules or sequence within a pair of dotted lines.  Circles label proteins.  Triangles label distinct structural features of double stranded DNA. What does each letter label?   Answers must be precise and complete to receive credit.

If an organism is diploid, and has 16 chromosomes in total, how many sets of homologous chromosomes does it possess?

You isolate mRNA from the pituitary gland and hypothalamus from the brain of a recently deceased (dead) man.  From this you intend to make cDNA. What enzyme would you use first to create the first strand of cDNA from the mRNA?

What enzymatic activity (function) does a restriction enzyme have?

SMS wrap is known for being:

Type 4 indicators react to:

What is the main purpose of tip protectors on surgical instruments?