Blog

___________ is important for moving materials between the living and nonliving components of an ecosystem.

Which of the following roles is played by fungi in the food chain?

Soon after the nurse administers an intradermal injection of an allergen to a patient’s forearm, the patient reports itching at the site, weakness, and dizziness. When administering care, which action would the nurse appropriately delegate to the certified nursing assistant (CNA)?

Several years later, the patient presents to the HIV clinic for a follow up appointment. Until recently, he has been doing well. The nurse’s physical assessment is negative except for the following:  Skin cool and clammy, patient reports frequent night sweats. Patient reports intermittent nausea and decreased appetite. Bilateral lymphadenopathy in neck and axilla. BP 128/78 mmHg, HR 98 bpm, RR 18, temperature 99.7 F oral, O2 sat 96% room air.   Labs/Diagnostics Results Reference Flag Viral load 100,000 copies/mL HIGH CD4 count 250 cells/mm3 LOW Candidiasis culture Negative NEGATIVE Chest X-Ray Negative, lungs clear bilaterally Based on the assessment data and diagnostic results above, what is the nurse’s priority concern?

https://m3a.vhlcentral.com/resources/programs/430/download/262841 Read these statements and multiple choice options. Then listen to the advertisement for Club Cosmos and select the correct option.   El Club Cosmos está en..,

What is the proper order of the following events in the expression of a eukaryotic gene?

What if the mutation was a deletion of a base pair, as shown below? What effect would that have on the protein that is translated? UCUAUGUUUCACAGAGGGAAACCCUAACCC (normal)   UCUAUGUUUCACAGGGGAAACCCUAACCC (mutant)

Describe 2 different levels that gene expression can be regulated, and go into some detail about how each works. In the description, include ways that the gene expression is either increased or decreased. (5 pts)      

On the previous exam’s material we discussed the inheritance genetics of the disease cystic fibrosis. Cystic fibrosis is caused by a mutation in a gene coding for a protein that transports chloride ions in lung epithelial tissue. This function is needed to have a normal amount of mucous in the lungs and when defective, as is in the case of cystic fibrosis, the lung mucous levels are too high. Explain in cellular terms, including transcription, translation and after translation, how a mutation in this gene would cause the transporter to not function. (5 pts)    

A stomach cell is producing pepsin, an enzyme that breaks down other proteins. Which of the following events suggests that gene expression of pepsin has been turned off in the cell?