Blog

What is the proper order of the following events in the expression of a eukaryotic gene?

What if the mutation was a deletion of a base pair, as shown below? What effect would that have on the protein that is translated? UCUAUGUUUCACAGAGGGAAACCCUAACCC (normal)   UCUAUGUUUCACAGGGGAAACCCUAACCC (mutant)

Describe 2 different levels that gene expression can be regulated, and go into some detail about how each works. In the description, include ways that the gene expression is either increased or decreased. (5 pts)      

On the previous exam’s material we discussed the inheritance genetics of the disease cystic fibrosis. Cystic fibrosis is caused by a mutation in a gene coding for a protein that transports chloride ions in lung epithelial tissue. This function is needed to have a normal amount of mucous in the lungs and when defective, as is in the case of cystic fibrosis, the lung mucous levels are too high. Explain in cellular terms, including transcription, translation and after translation, how a mutation in this gene would cause the transporter to not function. (5 pts)    

A stomach cell is producing pepsin, an enzyme that breaks down other proteins. Which of the following events suggests that gene expression of pepsin has been turned off in the cell?

What nucleotide sequence would be found on the complementary DNA strand of the strand shown here?

EXTRA CREDIT QUESTION 2. Answering incorrectly does not count off any points. (2.5 pts)   What is meant when it is said that the genetic code is universal?

A rabbit population consists of animals that are either very dark on top or very light on top. When examining them closely, biologists were surprised to find no rabbit with a medium darkness, intermediate to the two extremes. This is an example of

Which of the following is NOT true about transitional forms?

The earliest life forms date back to __________ years ago.