Author: Anonymous

What type of bonds does DNA ligase create between adjacent nucleotides?

The following diagram represents the transcription unit and corresponding RNA transcripts as “Christmas-tree-like” structures captured in the electron micrograph.     Which of the following statements CORRECTLY describes the orientation of the DNA and RNA transcript? (Select all that apply.)

Meier-Gorlin syndrome results from flaws in the licensing of origins in replication. Which is the most likely effect on DNA replication in effected individuals?

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?

For a given gene, both strands of a DNA are used as a template simultaneously from one initiation point when which of the following molecules is synthesized?

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

In the diagram below, which letter indicates the 5’ end of the leading strand?  

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, how many 3´ hydroxyls are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

What types of bonds are created between adjacent ribonucleotides during the process of transcription?