PCR is a clever procedure. What type of enzyme is used to make this procedure workable? Why? Where is this enzyme from?
Author: Anonymous
Transcribe the following DNA sequence: (in the first and thi…
Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end. Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’ Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon. This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation. Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]
In 1928 Fredrick Griffith experimented with two strains of S…
In 1928 Fredrick Griffith experimented with two strains of Streptococcus pneumoniae bacteria, smooth type (virulent) and rough type (non-virulent). If heat-killed S type was mixed with R type, the mixture was virulent. What was learned from this experiment?
Why are parasites so difficult to classify based on morpholo…
Why are parasites so difficult to classify based on morphology only?
All animals must get oxygen to tissues for cellular respirat…
All animals must get oxygen to tissues for cellular respiration. Which of the following is NOT involved in this critical function?
An organism has the following features: diplontic life cycle…
An organism has the following features: diplontic life cycle, protostome development, segmentation, a septate coelom, closed circulatory system, and setae. To which phylum does this organism belong?
A geneticist is studying sexual reproduction of a species of…
A geneticist is studying sexual reproduction of a species of butterfly that lives in a very cold climate. He hypothesizes that there should be low genetic diversity because it is well adapted to the cold climate but does not seem to be able to colonize surrounding areas with warmer climates. What important principle is he using to formulate his hypothesis?
*Adult echinoderms display radial symmetry. What evidence su…
*Adult echinoderms display radial symmetry. What evidence suggests that echinoderm ancestors evolved from bilaterally symmetrical ancestors?
A primary tissue types that consists of scattered cells in a…
A primary tissue types that consists of scattered cells in a noncellular matrix is _____ tissue.
The tissue whose function is to move oxygen, carbon dioxide,…
The tissue whose function is to move oxygen, carbon dioxide, nutrients, wastes, hormones, and heat around the body is _____.