You have to make an oral presentation in front of your class based on a topic you have researched over the course of the semester. How well you do will significantly affect your grade. Briefly describe how you would prepare for this event, and what strategies you would use to present your material successfully.
Author: Anonymous
Objectives, surveys, and 360-degree evaluations are methods…
Objectives, surveys, and 360-degree evaluations are methods to assess the performance of:
Why do the DNA fingerprints of non-related individuals diffe…
Why do the DNA fingerprints of non-related individuals differ?
Why is it important that the PCR enzyme be heat-stable?
Why is it important that the PCR enzyme be heat-stable?
Ligase forms [a] bonds between 5’ phosphate groups and 3’ -O…
Ligase forms [a] bonds between 5’ phosphate groups and 3’ -OH groups in DNA. Reverse transcriptase uses [c] as a template to form a complimentary [d] strand. RNA polymerase binds to the [b] (write coding or non-coding) DNA strand and forms a complimentary molecule of [e], through the process of trans[f]. The monomer units of proteins are [g]
Why do we need to stain DNA after gel electrophoresis?
Why do we need to stain DNA after gel electrophoresis?
After we transformed the bacterial cells, we plated them on…
After we transformed the bacterial cells, we plated them on both plain (no antibiotic) and antibiotic-containing agar plates. Why did we get only a few colonies of transformed cells on the antibiotic plate when the plain plate was covered in colonies?
PCR is a clever procedure. What type of enzyme is used to m…
PCR is a clever procedure. What type of enzyme is used to make this procedure workable? Why? Where is this enzyme from?
Transcribe the following DNA sequence: (in the first and thi…
Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end. Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’ Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon. This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation. Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]
In 1928 Fredrick Griffith experimented with two strains of S…
In 1928 Fredrick Griffith experimented with two strains of Streptococcus pneumoniae bacteria, smooth type (virulent) and rough type (non-virulent). If heat-killed S type was mixed with R type, the mixture was virulent. What was learned from this experiment?