You vaccinate a patient against tetanus. The tetanus vaccine consists of a toxoid molecule, which, when injected, causes patients to produce antibodies to the tetanus toxin. How does this occur?
Author: Anonymous
In a different set of experiments, you identify two kinds of…
In a different set of experiments, you identify two kinds of mutations in S. aureus. The first type of mutation makes the bacteria more susceptible to antibiotic X; the second type of mutation makes it more resistant to antibiotic X. In the absence of the antibiotic, which mutant would you expect to be more abundant?
When a foreign invader infects a human host, what is likely…
When a foreign invader infects a human host, what is likely the first responder for the immune system?
The ability to react more strongly to a subsequent infection…
The ability to react more strongly to a subsequent infection is a feature of which of the following?
What is a MOTO-CAR?
What is a MOTO-CAR?
Which one of the following statements about restriction frag…
Which one of the following statements about restriction fragment length polymorphisms (RFLPs) is correct?
You are a doctor examining a patient’s blood test reports. Y…
You are a doctor examining a patient’s blood test reports. You are looking at the ratio of helper T cells and cytotoxic T cells. Helper T cells ________; cytotoxic T cells ________. You can tell them apart by the type of protein they ________.
Which of the following describes adaptive immunity?
Which of the following describes adaptive immunity?
The job of a natural killer cell is to ________.
The job of a natural killer cell is to ________.
Here is a guide to what the following diagram means: K and…
Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing). An alien ship crash lands in Payson, UT. As part of a secret government team, you go to investigate, where you find an alien life form with an RNA polymerase that, strangely, transcribes DNA from the 3′ to 5′ direction (a feature never seen on Earth). Imagine that the alien polymerase were to transcribe strand K. What would be the outcome? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC