HLA-DRB1*15:01 differs from DRB1*01:01 by a G to C base chan…

HLA-DRB1*15:01 differs from DRB1*01:01 by a G to C base change. If the sequence surrounding the base change is … GGGTGCGGTTGCTGGAAAGAT … (DRB1*01:01) or … GGGTGCGGTTCCTGGAAAGAT … (DRB1*15:01), which of the following would be the 3′ end of a sequence-specific primer for detection of DRB1*15:01?

How many of them (a.i, a.j, a.k, b.i, b.j and b.k) can be pr…

How many of them (a.i, a.j, a.k, b.i, b.j and b.k) can be printed in the question mark area? [ans] Click to Show Image Description Left code block package p1; public class A {    int i = 5;    private int j = 10;    protected int k = 15;} Right code block package p2; import p1.*; public class B extends A {    public static void main(String[] args) {        A a = new A();        B b = new B();        System.out.println(?);    }}

For the seven indicated statements in method m3(), how many…

For the seven indicated statements in method m3(), how many of them are ok to be executed? [ans] Click to Show Image Description Top-left code block package p1; public class A {    protected int i;    private int j;     void m1() { }     public void m2() { }} Bottom-left code block package p2; import p1.A; public class B extends A {    int k;} Right code block package p2; import p1.A; public class C extends B {    private int m;     void m3() {        A a = new C();        System.out.print(a.i);    // statement 1        System.out.print(a.j);    // statement 2        System.out.print(a.k);    // statement 3        System.out.print(a.m);    // statement 4        a.m1();                   // statement 5        a.m2();                   // statement 6        a.m3();                   // statement 7    }}